circad | circRNAs associated with diseases

cANRIL
Gene	ANRIL	Organism	Rat
Genome Locus	n/a	Build	n/a
Disease	Atherosclerosis	ICD-10	Atherosclerosis (I70)
DBLink	Link to database	PMID	28683453
Experimental Method
Sample Type	Blood samples	Comparison	Sixty Wistar rats were randomly assigned into control, model, empty vector, over-expressed cANRIL and low-expressed cANRIL groups (12 rats in each group).
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCTCTATCCGCCAATCAGG Reverse GGGCCTCAGTGGCACATACC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Song, CL, Wang, JP, Xue, X, Liu, N, Zhang, XH, Zhao, Z, Liu, JG, Zhang, CP, Piao, ZH, Liu, Y, Yang, YB (2017). Effect of Circular ANRIL on the Inflammatory Response of Vascular Endothelial Cells in a Rat Model of Coronary Atherosclerosis. Cell. Physiol. Biochem., 42, 3:1202-1212.